cell lines hut78 atcc tib Search Results


hut78  (ATCC)
94
ATCC hut78
FIG. 1. Luciferase reporter gene assays of <t>HUT78</t> T cells using 2195 wild- type (W.T.) RANTES promoter and indicated sequences deleted (del) inter- nally. NFIL6 binding site homology is underlined. The results are presented as normalized (to cotransfected cytomegalovirus promoter b-galactosidase reporter construct) light units. The absence of an error bar indicates an error too low to be recognized by the graphing program.
Hut78, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hut78+atcc+tib/HuT+78%3B+Cutaneous+T+Cell+Lymphoma%3B+Human/10__1128_slash_mcb__16__1__202-34-0-1
Average 94 stars, based on 1 article reviews
hut78 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
ATCC human cutaneous t cell lymphoma cell lines
FIG. 1. Luciferase reporter gene assays of <t>HUT78</t> T cells using 2195 wild- type (W.T.) RANTES promoter and indicated sequences deleted (del) inter- nally. NFIL6 binding site homology is underlined. The results are presented as normalized (to cotransfected cytomegalovirus promoter b-galactosidase reporter construct) light units. The absence of an error bar indicates an error too low to be recognized by the graphing program.
Human Cutaneous T Cell Lymphoma Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hut78+atcc+tib/HuT+78%3B+Cutaneous+T+Cell+Lymphoma%3B+Human/pmc11503255-32-0-13
Average 93 stars, based on 1 article reviews
human cutaneous t cell lymphoma cell lines - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


FIG. 1. Luciferase reporter gene assays of HUT78 T cells using 2195 wild- type (W.T.) RANTES promoter and indicated sequences deleted (del) inter- nally. NFIL6 binding site homology is underlined. The results are presented as normalized (to cotransfected cytomegalovirus promoter b-galactosidase reporter construct) light units. The absence of an error bar indicates an error too low to be recognized by the graphing program.

Journal: Molecular and Cellular Biology

Article Title: Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation

doi: 10.1128/mcb.16.1.202

Figure Lengend Snippet: FIG. 1. Luciferase reporter gene assays of HUT78 T cells using 2195 wild- type (W.T.) RANTES promoter and indicated sequences deleted (del) inter- nally. NFIL6 binding site homology is underlined. The results are presented as normalized (to cotransfected cytomegalovirus promoter b-galactosidase reporter construct) light units. The absence of an error bar indicates an error too low to be recognized by the graphing program.

Article Snippet: HUT78 (ATCC TIB 161), Jurkat (ATCC TIB 152), Burkitt’s B-lymphoma cell lines MS (50) and Daudi (ATCC CCL 213), PEER (a gd T-cell line), and normal peripheral blood lymphocytes (PBL) were cultured in RPMI 1640 medium (Irvine Scientific, Santa Ana, Calif.) supplemented with 2 mM L-glutamine, 100 U of penicillin G per ml, 100 U of streptomycin per ml, and 10% heat-inactivated fetal calf serum (HyClone Laboratories, Inc. Logan, Utah).

Techniques: Luciferase, Binding Assay, Construct

FIG. 3. R(C) site point mutations eliminate nuclear factor binding and im- pair RANTES promoter activity. (A) EMSA with 32P-labeled R(C) oligonucle- otide (sequences 2187 to 2164) and R(C)-M [same as R(C) except G residues indicated by asterisks in Fig. 2B are altered to T). (B) Luciferase reporter gene assays of HUT78 T-cells with the 2195 wild-type (W.T.) promoter. The 2195 R(C)mutant (mut) is identical to 2195 except that the same G-to-T mutations as described for the R(C)-M oligonucleotide in panel A were introduced. The region C deletion is described in the legend to Fig. 1. The results are the averages for two experiments using two different sets of plasmid preparations.

Journal: Molecular and Cellular Biology

Article Title: Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation

doi: 10.1128/mcb.16.1.202

Figure Lengend Snippet: FIG. 3. R(C) site point mutations eliminate nuclear factor binding and im- pair RANTES promoter activity. (A) EMSA with 32P-labeled R(C) oligonucle- otide (sequences 2187 to 2164) and R(C)-M [same as R(C) except G residues indicated by asterisks in Fig. 2B are altered to T). (B) Luciferase reporter gene assays of HUT78 T-cells with the 2195 wild-type (W.T.) promoter. The 2195 R(C)mutant (mut) is identical to 2195 except that the same G-to-T mutations as described for the R(C)-M oligonucleotide in panel A were introduced. The region C deletion is described in the legend to Fig. 1. The results are the averages for two experiments using two different sets of plasmid preparations.

Article Snippet: HUT78 (ATCC TIB 161), Jurkat (ATCC TIB 152), Burkitt’s B-lymphoma cell lines MS (50) and Daudi (ATCC CCL 213), PEER (a gd T-cell line), and normal peripheral blood lymphocytes (PBL) were cultured in RPMI 1640 medium (Irvine Scientific, Santa Ana, Calif.) supplemented with 2 mM L-glutamine, 100 U of penicillin G per ml, 100 U of streptomycin per ml, and 10% heat-inactivated fetal calf serum (HyClone Laboratories, Inc. Logan, Utah).

Techniques: Binding Assay, Activity Assay, Labeling, Luciferase, Mutagenesis, Plasmid Preparation

FIG. 4. Characterization of the R(C) binding complex. (A) EMSA using 32P-labeled R(C) oligonucleotide probe and nuclear extracts from the indicated cell lines. The arrow points to the major complex. Fibro, normal human dermal fibroblasts. (B) EMSA using the same probe described for panel A and nuclear extracts prepared at the indicated time points in a peripheral blood T-cell activation time course. CTL, normal human cytolytic T-cell line (5). (C) R(C) site recognition by HUT78-derived nuclear proteins is sequence specific. Cold competition EMSA using labeled R(C) site oligonucleotide and unlabeled excess oligonucleotides as indicated. The NFAT sequence is from the human IL-2 promoter (GATCGGAGGAAAAACTGTTTCATACAGAAGGCGTGATC) (8). (D) UV cross-linking analysis of factors bound to the R(C) oligonucleotide in 5-day PHA-treated PBL and HUT78 T cells. The positions of the molecular mass markers (in kilodaltons) are indicated on the right. Arrows point to repro- ducibly cross-linked products.

Journal: Molecular and Cellular Biology

Article Title: Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation

doi: 10.1128/mcb.16.1.202

Figure Lengend Snippet: FIG. 4. Characterization of the R(C) binding complex. (A) EMSA using 32P-labeled R(C) oligonucleotide probe and nuclear extracts from the indicated cell lines. The arrow points to the major complex. Fibro, normal human dermal fibroblasts. (B) EMSA using the same probe described for panel A and nuclear extracts prepared at the indicated time points in a peripheral blood T-cell activation time course. CTL, normal human cytolytic T-cell line (5). (C) R(C) site recognition by HUT78-derived nuclear proteins is sequence specific. Cold competition EMSA using labeled R(C) site oligonucleotide and unlabeled excess oligonucleotides as indicated. The NFAT sequence is from the human IL-2 promoter (GATCGGAGGAAAAACTGTTTCATACAGAAGGCGTGATC) (8). (D) UV cross-linking analysis of factors bound to the R(C) oligonucleotide in 5-day PHA-treated PBL and HUT78 T cells. The positions of the molecular mass markers (in kilodaltons) are indicated on the right. Arrows point to repro- ducibly cross-linked products.

Article Snippet: HUT78 (ATCC TIB 161), Jurkat (ATCC TIB 152), Burkitt’s B-lymphoma cell lines MS (50) and Daudi (ATCC CCL 213), PEER (a gd T-cell line), and normal peripheral blood lymphocytes (PBL) were cultured in RPMI 1640 medium (Irvine Scientific, Santa Ana, Calif.) supplemented with 2 mM L-glutamine, 100 U of penicillin G per ml, 100 U of streptomycin per ml, and 10% heat-inactivated fetal calf serum (HyClone Laboratories, Inc. Logan, Utah).

Techniques: Binding Assay, Labeling, Activation Assay, Derivative Assay, Sequencing

FIG. 5. The region E binding complex contains NFIL6/C/EBPb. (A) EMSA using 32P-labeled region E oligonucleotide and HUT78 nuclear extract. Cold oligonucleotide competitors were used in 1,000-fold molar excess. ‘‘E,’’ homologous oligonucleotide; C/EBP, C/EBP consensus binding site (Santa Cruz Biotech catalog no. sc-2525); Kappa B, NF-kB binding sequence from immunoglobulin kappa light-chain enhancer (TCGAGTCAGAGGGGACTTTCCGAGTCGA) (49); irr, irrelevant sequence oligonucleotide (GATCCTGGAAGGGAGAGTGGAGATC). (B) EMSA-antibody supershift/blocking assay using the probe and extracts de- scribed for panel A. Rabbit polyclonal immunoglobulin G (1 mg) was added as described in Materials and Methods. Alpha, beta, and delta refer to the specific C/EBP family members against which the antisera are directed (Santa Cruz Biotech). The arrow points to the blocked EMSA complex. (C) Similar to the assay described for panel B but with nuclear extracts from both HUT78 T cells and PBL 3 days after PHA treatment. Antisera were added as indicated. The lower arrow points to the C/EBPb/NFIL6 complex. The upper arrow indicates the additional late PBL-derived EMSA complex. CNTRL, control.

Journal: Molecular and Cellular Biology

Article Title: Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation

doi: 10.1128/mcb.16.1.202

Figure Lengend Snippet: FIG. 5. The region E binding complex contains NFIL6/C/EBPb. (A) EMSA using 32P-labeled region E oligonucleotide and HUT78 nuclear extract. Cold oligonucleotide competitors were used in 1,000-fold molar excess. ‘‘E,’’ homologous oligonucleotide; C/EBP, C/EBP consensus binding site (Santa Cruz Biotech catalog no. sc-2525); Kappa B, NF-kB binding sequence from immunoglobulin kappa light-chain enhancer (TCGAGTCAGAGGGGACTTTCCGAGTCGA) (49); irr, irrelevant sequence oligonucleotide (GATCCTGGAAGGGAGAGTGGAGATC). (B) EMSA-antibody supershift/blocking assay using the probe and extracts de- scribed for panel A. Rabbit polyclonal immunoglobulin G (1 mg) was added as described in Materials and Methods. Alpha, beta, and delta refer to the specific C/EBP family members against which the antisera are directed (Santa Cruz Biotech). The arrow points to the blocked EMSA complex. (C) Similar to the assay described for panel B but with nuclear extracts from both HUT78 T cells and PBL 3 days after PHA treatment. Antisera were added as indicated. The lower arrow points to the C/EBPb/NFIL6 complex. The upper arrow indicates the additional late PBL-derived EMSA complex. CNTRL, control.

Article Snippet: HUT78 (ATCC TIB 161), Jurkat (ATCC TIB 152), Burkitt’s B-lymphoma cell lines MS (50) and Daudi (ATCC CCL 213), PEER (a gd T-cell line), and normal peripheral blood lymphocytes (PBL) were cultured in RPMI 1640 medium (Irvine Scientific, Santa Ana, Calif.) supplemented with 2 mM L-glutamine, 100 U of penicillin G per ml, 100 U of streptomycin per ml, and 10% heat-inactivated fetal calf serum (HyClone Laboratories, Inc. Logan, Utah).

Techniques: Binding Assay, Labeling, Sequencing, Blocking Assay, Derivative Assay, Control